Human CER1 Gene cDNA Clone (full-length ORF Clone), espression ready, FLAG-tagged

Hersteller Sino Biological
Kategorie
Typ cDNA Clone
Specific against Human
Clon 804
Menge 1 Unit
ArtNr HG10820-M-F
Eclass 6.1 34160990
Eclass 9.0 32160414
Lieferbar
Gene Bank Ref.ID
NM_005454.2
Gene Synonym
DAND4, MGC96951, MGC119894, MGC119895, CER1
Molecule
CER1
cDNA Size
804
Vector
pCMV2-FLAG
cDNA Description
ORF Clone of Homo sapiens cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis) DNA.
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Sequence
ATGCATCTCC TCTTATTTCA GCTGCTGGTA CTCCTGCCTC TAGGAAAGAC CACACGGCAC CAGGATGGCC GCCAGAATCA GAGTTCTCTT TCCCCCGTAC TCCTGCCAAG GAATCAAAGA GAGCTTCCCA CAGGCAACCA TGAGGAAGCT GAGGAGAAGC CAGATCTGTT TGTCGCAGTG CCACACCTTG TAGCCACCAG CCCTGCAGGG GAAGGCCAGA GGCAGAGAGA GAAGATGCTG TCCAGATTTG GCAGGTTCTG GAAGAAGCCT GAGAGAGAAA TGCATCCATC CAGGGACTCA GATAGTGAGC CCTTCCCACC TGGGACCCAG TCCCTCATCC AGCCGATAGA TGGAATGAAA ATGGAGAAAT CTCCTCTTCG GGAAGAAGCC AAGAAATTCT GGCACCACTT CATGTTCAGA AAAACTCCGG CTTCTCAGGG GGTCATCTTG CCCATCAAAA GCCATGAAGT ACATTGGGAG ACCTGCAGGA CAGTGCCCTT CAGCCAGACT ATAACCCACG AAGGCTGTGA AAAAGTAGTT GTTCAGAACA ACCTTTGCTT TGGGAAATGC GGGTCTGTTC ATTTTCCTGG AGCCGCGCAG CACTCCCATA CCTCCTGCTC TCACTGTTTG CCTGCCAAGT TCACCACGAT GCACTTGCCA CTGAACTGCA CTGAACTTTC CTCCGTGATC AAGGTGGTGA TGCTGGTGGA GGAGTGCCAG TGCAAGGTGA AGACGGAGCA TGAAGATGGA CACATCCTAC ATGCTGGCTC CCAGGATTCC TTTATCCCAG GAGTTTCAGC TGGGGGTGGA GGCTCTGATT ACAAGGATGA CGACGATAAG TAA
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note
1. GGGGS linker is commonly used, because of their flexibility and resistance to proteases, which has no influence on protein expression. 2. FLAG Tag
Restriction site
KpnI + XhoI
Menge: 1 Unit
Lieferbar: In stock
Listenpreis: 212,91 €
Preis: 212,91 €
lieferbar

Angebot anfordern

Fragen zum Produkt?

Ihr Ansprechpartner:

Arne Pelz

sales@hoelzel.de

Schließen