Human S100A12 Gene cDNA Clone (full-length ORF Clone), espression ready, FLAG-tagged

Hersteller Sino Biological
Kategorie
Typ cDNA Clone
Specific against Human
Clon 279
Menge 1 Unit
ArtNr HG11143-M-F
Eclass 6.1 34160990
Eclass 9.0 32160414
Lieferbar
Gene Bank Ref.ID
NM_005621.1
Gene Synonym
p6, CAGC, CGRP, MRP6, CAAF1, ENRAGE, S100A12
Molecule
S100A12
cDNA Size
279
Vector
pCMV2-FLAG
cDNA Description
ORF Clone of Homo sapiens S100 calcium binding protein A5 DNA.
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Sequence
ATGACAAAAC TTGAAGAGCA TCTGGAGGGA ATTGTCAATA TCTTCCACCA ATACTCAGTT CGGAAGGGGC ATTTTGACAC CCTCTCTAAG GGTGAGCTGA AGCAGCTGCT TACAAAGGAG CTTGCAAACA CCATCAAGAA TATCAAAGAT AAAGCTGTCA TTGATGAAAT ATTCCAAGGC CTGGATGCTA ATCAAGATGA ACAGGTCGAC TTTCAAGAAT TCATATCCCT GGTAGCCATT GCGCTGAAGG CTGCCCATTA CCACACCCAC AAAGAGGGGG GTGGAGGCTC TGATTACAAG GATGACGACG ATAAGTAA
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note
1. GGGGS linker is commonly used, because of their flexibility and resistance to proteases, which has no influence on protein expression. 2. FLAG Tag
Restriction site
HindIII + XhoI
Menge: 1 Unit
Lieferbar: In stock
Listenpreis: 212,91 €
Preis: 212,91 €
lieferbar

Vergleichen

Angebot anfordern

Fragen zum Produkt?

Ihr Ansprechpartner:

Arne Pelz

sales@hoelzel.de

 
Schließen