Human CD276 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), espression ready, FLAG-tagged

Hersteller Sino Biological
Kategorie Produkte / Clone
Typ cDNA Clone
Specific against Human
Clon 1605
Menge 1 Unit
ArtNr HG11188-M-F
Eclass 6.1 34160990
Eclass 9.0 32160414
Lieferbar
Gene Bank Ref.ID
NM_001024736.1
Gene Synonym
B7H3, B7-H3, CD276
Molecule
CD276
cDNA Size
1605
Vector
pCMV2-FLAG
cDNA Description
ORF Clone of Homo sapiens CD276 molecule transcript variant 1 DNA.
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Sequence
ATGCTGCGTC GGCGGGGCAG CCCTGGCATG GGTGTGCATG TGGGTGCAGC CCTGGGAGCA CTGTGGTTCT GCCTCACAGG AGCCCTGGAG GTCCAGGTCC CTGAAGACCC AGTGGTGGCA CTGGTGGGCA CCGATGCCAC CCTGTGCTGC TCCTTCTCCC CTGAGCCTGG CTTCAGCCTG GCACAGCTCA ACCTCATCTG GCAGCTGACA GATACCAAAC AGCTGGTGCA CAGCTTTGCT GAGGGCCAGG ACCAGGGCAG CGCCTATGCC AACCGCACGG CCCTCTTCCC GGACCTGCTG GCACAGGGCA ACGCATCCCT GAGGCTGCAG CGCGTGCGTG TGGCGGACGA GGGCAGCTTC ACCTGCTTCG TGAGCATCCG GGATTTCGGC AGCGCTGCCG TCAGCCTGCA GGTGGCCGCT CCCTACTCGA AGCCCAGCAT GACCCTGGAG CCCAACAAGG ACCTGCGGCC AGGGGACACG GTGACCATCA CGTGCTCCAG CTACCAGGGC TACCCTGAGG CTGAGGTGTT CTGGCAGGAT GGGCAGGGTG TGCCCCTGAC TGGCAACGTG ACCACGTCGC AGATGGCCAA CGAGCAGGGC TTGTTTGATG TGCACAGCAT CCTGCGGGTG GTGCTGGGTG CAAATGGCAC CTACAGCTGC CTGGTGCGCA ACCCCGTGCT GCAGCAGGAT GCGCACAGCT CTGTCACCAT CACACCCCAG AGAAGCCCCA CAGGAGCCGT GGAGGTCCAG GTCCCTGAGG ACCCGGTGGT GGCCCTAGTG GGCACCGATG CCACCCTGCG CTGCTCCTTC TCCCCCGAGC CTGGCTTCAG CCTGGCACAG CTCAACCTCA TCTGGCAGCT GACAGACACC AAACAGCTGG TGCACAGTTT CACCGAAGGC CGGGACCAGG GCAGCGCCTA TGCCAACCGC ACGGCCCTCT TCCCGGACCT GCTGGCACAA GGCAATGCAT CCCTGAGGCT GCAGCGCGTG CGTGTGGCGG ACGAGGGCAG CTTCACCTGC TTCGTGAGCA TCCGGGATTT CGGCAGCGCT GCCGTCAGCC TGCAGGTGGC CGCTCCCTAC TCGAAGCCCA GCATGACCCT GGAGCCCAAC AAGGACCTGC GGCCAGGGGA CACGGTGACC ATCACGTGCT CCAGCTACCG GGGCTACCCT GAGGCTGAGG TGTTCTGGCA GGATGGGCAG GGTGTGCCCC TGACTGGCAA CGTGACCACG TCGCAGATGG CCAACGAGCA GGGCTTGTTT GATGTGCACA GCGTCCTGCG GGTGGTGCTG GGTGCGAATG GCACCTACAG CTGCCTGGTG CGCAACCCCG TGCTGCAGCA GGATGCGCAC GGCTCTGTCA CCATCACAGG GCAGCCTATG ACATTCCCCC CAGAGGCCCT GTGGGTGACC GTGGGGCTGT CTGTCTGTCT CATTGCACTG CTGGTGGCCC TGGCTTTCGT GTGCTGGAGA AAGATCAAAC AGAGCTGTGA GGAGGAGAAT GCAGGAGCTG AGGACCAGGA TGGGGAGGGA GAAGGCTCCA AGACAGCCCT GCAGCCTCTG AAACACTCTG ACAGCAAAGA AGATGATGGA CAAGAAATAG CCGGGGGTGG AGGCTCTGAT TACAAGGATG ACGACGATAA GTAA
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note
1. GGGGS linker is commonly used, because of their flexibility and resistance to proteases, which has no influence on protein expression. 2. FLAG Tag
Restriction site
KpnI + XhoI
Menge: 1 Unit
Lieferbar: In stock
Listenpreis: 222,98 €
Preis: 222,98 €
lieferbar

Angebot anfordern

Technische Fragen zu diesem Produkt?


Salesmanager: Arne Pelz

Email: sales@hoelzel.de

Schließen