Human CHP1 Gene cDNA Clone (full-length ORF Clone), espression ready, FLAG-tagged

Hersteller Sino Biological
Kategorie
Typ cDNA Clone
Specific against Human
Clon 588
Menge 1 Unit
ArtNr HG11379-M-F
Eclass 6.1 34160990
Eclass 9.0 32160414
Lieferbar
Gene Bank Ref.ID
NM_007236.4
Gene Synonym
CHP, SLC9A1BP
Molecule
CHP1
cDNA Size
588
Vector
pCMV2-FLAG
cDNA Description
ORF Clone of Homo sapiens calcineurin-like EF-hand protein 1 DNA.
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Sequence
ATGGGTTCTC GGGCCTCCAC GTTACTGCGG GACGAAGAGC TCGAGGAGAT CAAGAAGGAG ACCGGCTTTT CCCACAGTCA AATCACTCGC CTCTACAGCC GGTTCACCAG CCTGGACAAA GGAGAGAATG GGACTCTCAG CCGGGAAGAT TTCCAGAGGA TTCCAGAACT TGCCATCAAC CCACTGGGGG ACCGGATCAT CAATGCCTTC TTTCCAGAGG GAGAGGACCA GGTAAACTTC CGTGGATTCA TGCGAACTTT GGCTCATTTC CGCCCCATTG AGGATAATGA AAAGAGCAAA GATGTGAATG GACCCGAACC ACTCAACAGC CGAAGCAACA AACTGCACTT TGCTTTTCGA CTATATGATT TGGATAAAGA TGAAAAGATC TCCCGTGATG AGCTGTTACA GGTGCTACGC ATGATGGTCG GAGTAAATAT CTCAGATGAG CAGCTGGGCA GCATCGCAGA CAGGACCATT CAGGAGGCTG ATCAGGATGG GGACAGTGCC ATATCTTTCA CAGAATTTGT TAAGGTTTTG GAGAAGGTGG ATGTAGAACA GAAAATGAGC ATCCGATTTC TTCACGGGGG TGGAGGCTCT GATTACAAGG ATGACGACGA TAAGTAA
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note
1. GGGGS linker is commonly used, because of their flexibility and resistance to proteases, which has no influence on protein expression. 2. FLAG Tag
Restriction site
KpnI + XbaI
Menge: 1 Unit
Lieferbar: In stock
Listenpreis: 212,91 €
Preis: 212,91 €
lieferbar

Vergleichen

Angebot anfordern

Fragen zum Produkt?

Ihr Ansprechpartner:

Arne Pelz

sales@hoelzel.de

 
Schließen