Human PMP22 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

Manufacturer Sino Biological
Category Products / Clone
Type cDNA Clone
Specific against Human
Amount 1 Unit
ArtNr HG14519-G-F
Eclass 6.1 34160990
Eclass 9.0 32160414
Available
Gene Bank Ref.ID
BC019040
Gene Synonym
DSS, HNPP, CMT1A, CMT1E, GAS-3, Sp110, HMSNIA
Molecule
PMP22
cDNA Size
483
Vector
pCMV/hygro-FLAG
cDNA Description
ORF Clone of Homo sapiens peripheral myelin protein 22 DNA.
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Sequence
ATGCTCCTCC TGTTGCTGAG TATCATCGTC CTCCACGTCG CGGTGCTGGT GCTGCTGTTC GTCTCCACGA TCGTCAGCCA ATGGATCGTG GGCAATGGAC ACGCAACTGA TCTCTGGCAG AACTGTAGCA CCTCTTCCTC AGGAAATGTC CACCACTGTT TCTCATCATC ACCAAACGAA TGGCTGCAGT CTGTCCAGGC CACCATGATC CTGTCGATCA TCTTCAGCAT TCTGTCTCTG TTCCTGTTCT TCTGCCAACT CTTCACCCTC ACCAAGGGGG GCAGGTTTTA CATCACTGGA ATCTTCCAAA TTCTTGCTGG TCTGTGCGTG ATGAGTGCTG CGGCCATCTA CACGGTGAGG CACCCGGAGT GGCATCTCAA CTCGGATTAC TCCTACGGTT TCGCCTACAT CCTGGCCTGG GTGGCCTTCC CCCTGGCCCT TCTCAGCGGT GTCATCTATG TGATCTTGCG GAAACGCGAA GCTGATTACA AGGATGACGA CGATAAGTAA
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note
1. GCT was the nucleotide residue from the restriction site during plasmid construction, which has no influence on protein expression. 2. FLAG Tag
Restriction site
KpnI + XhoI
Amount: 1 Unit
Available: In stock
Listprice: €98.28
Price: €98.28
lieferbar

Get an offer

Technische Fragen zu diesem Produkt?


Salesmanager: Arne Pelz

Email: sales@hoelzel.de

Instruction sheet

HG14519-G-F.pdf