Human CHRFAM7A Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

Manufacturer Sino Biological
Category Products / Clone
Type cDNA Clone
Specific against Human
Clone 1266
Amount 1 Unit
ArtNr HG15733-G-F
Eclass 6.1 34160990
Eclass 9.0 32160414
Available
Gene Bank Ref.ID
BC101348
Gene Synonym
D-10, CHRNA7, CHRNA7-DR1
Molecule
CHRFAM7A
cDNA Size
1239
Vector
pCMV/hygro-FLAG
cDNA Description
ORF Clone of Homo sapiens CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion DNA.
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Sequence
ATGCAAAAAT ATTGCATCTA CCAGCATTTT CAGTTCCAAT TGCTAATCCA GCATTTGTGG ATAGCTGCAA ACTGCGATAT TGCTGATGAG CGCTTTGACG CCACATTCCA CACTAACGTG TTGGTGAATT CTTCTGGGCA TTGCCAGTAC CTGCCTCCAG GCATATTCAA GAGTTCCTGC TACATCGATG TACGCTGGTT TCCCTTTGAT GTGCAGCACT GCAAACTGAA GTTTGGGTCC TGGTCTTACG GAGGCTGGTC CTTGGATCTG CAGATGCAGG AGGCAGATAT CAGTGGCTAT ATCCCCAATG GAGAATGGGA CCTAGTGGGA ATCCCCGGCA AGAGGAGTGA AAGGTTCTAT GAGTGCTGCA AAGAGCCCTA CCCCGATGTC ACCTTCACAG TGACCATGCG CCGCAGGACA CTCTACTATG GCCTCAACCT GCTGATCCCC TGTGTGCTCA TCTCCGCCCT CGCCCTGCTG GTGTTCCTGC TTCCTGCAGA TTCCGGGGAG AAGATTTCCC TGGGGATAAC AGTCTTACTC TCTCTTACCG TCTTCATGCT GCTCGTGGCT GAGATCATGC CCGCAACATC CGATTCGGTA CCATTGATAG CCCAGTACTT CGCCAGCACC ATGATCATCG TGGGCCTCTC GGTGGTGGTG ACGGTGATCG TGCTGCAGTA CCACCACCAC GACCCCGACG GGGGCAAGAT GCCCAAGTGG ACCAGAGTCA TCCTTCTGAA CTGGTGCGCG TGGTTCCTGC GAATGAAGAG GCCCGGGGAG GACAAGGTGC GCCCGGCCTG CCAGCACAAG CAGCGGCGCT GCAGCCTGGC CAGTGTGGAG ATGAGCGCCG TGGCGCCGCC GCCCGCCAGC AACGGGAACC TGCTGTACAT CGGCTTCCGC GGCCTGGACG GCGTGCACTG TGTCCCGACC CCCGACTCTG GGGTAGTGTG TGGCCGCATG GCCTGCTCCC CCACGCACGA TGAGCACCTC CTGCACGGTG GGCAACCCCC CGAGGGGGAC CCGGACTTGG CCAAGATCCT GGAGGAGGTC CGCTACATTG CCAACCGCTT CCGCTGCCAG GACGAAAGCG AGGCGGTCTG CAGCGAGTGG AAGTTCGCCG CCTGTGTGGT GGACCGCCTG TGCCTCATGG CCTTCTCGGT CTTCACCATC ATCTGCACCA TCGGCATCCT GATGTCGGCT CCCAACTTCG TGGAGGCCGT GTCCAAAGAC TTTGCGGCTG ATTACAAGGA TGACGACGAT AAGTAA
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note
1. GCT was the nucleotide residue from the restriction site during plasmid construction, which has no influence on protein expression. 2. FLAG Tag
Restriction site
HindIII + XhoI
Amount: 1 Unit
Available: In stock
Listprice: €138.96
Price: €138.96
lieferbar

Get an offer

Technische Fragen zu diesem Produkt?


Salesmanager: Arne Pelz

Email: sales@hoelzel.de

Instruction sheet

HG15733-G-F.pdf