Vergleich

MIRacle rno-miR-3065-3p miRNA Agomir/Antagomir

ArtNr ACG-AM5103
Hersteller AcceGen
Menge 1 ea
Quantity options 2 OD 4 OD 5 OD
Kategorie
Typ RNA
Specific against other
ECLASS 10.1 32160414
ECLASS 11.0 32160414
UNSPSC 41105324
Lieferbar
Shipping Temperature
Ice pack
Description
Accession Number: MIMAT0017840
Mature Sequence UCAGCACCAGGAUAUUGUUGGGGA
rno-miR-3065-3p are small non-coding RNAs of 20–22 nucleotides, typically excised from 60–110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression.
AcceGen Biotech has extended experience in agomir/antagomir synthesis services that cover all human, mouse and rat miRNAs in the current miRbase (http://www.mirbase.org/). Compared to standard miRNA mimics and inhibitors, agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.
Deliverables: Agomir and/or antagomir, DEPC H2O.
1 OD corresponds to 33 ug.

Hinweis: Die dargestellten Informationen und Dokumente (Bedienungsanleitung, Produktdatenblatt, Sicherheitsdatenblatt und Analysezertifikat) entsprechen unserem letzten Update und sollten lediglich der Orientierung dienen. Wir übernehmen keine Garantie für die Aktualität. Für spezifische Anforderungen bitten wir Sie, uns eine Anfrage zu stellen.

Alle Produkte sind nur für Forschungszwecke bestimmt. Nicht für den menschlichen, tierärztlichen oder therapeutischen Gebrauch.

Menge: 1 ea
Lieferbar: Out of stock
Fragen zum Produkt?
 
Schließen