ResDetFast™ rcAAV-5/N Assay Kit

This kit is intended for quantitative detection of the contamination rate of rcAAV-5/N* in serotype rAAV-5/N (where N represents different capsid serotypes). Sample types include, but are not limited to, recombinant adeno-associated virus vector harvest fluid, production end-stage cells, purified viral vector stock, and cell samples for detecting rcAAV based on cell culture methods.
*Note: Before using this kit, please ensure the following:
1) AAV serotype;
2) The Inverted Terminal Repeat (ITR) of the test sample rAAV matches the following sequence:
CTCTCCCCCCTGTCGCGTTCGCTCGCTCGCTGGCTCGTTTGGGGGGGTGGCAGCTCAAAGAGCTGCCA GACGACGGCCCTCTGGCCGTCGCCCCCCCAAACGAGCCAGCGAGCGAGCGAACGCGACAGGGGGGAGAG TGCCACACTCTCAAGCAAGGGGGT