Comparison

CETN2 cDNA

Item no. NKM-ATGD0221-10ug
Manufacturer NKMAX
Amount 10 ug
Category
Type cDNA
Format Lyophilized
Specific against Human (Homo sapiens)
Sequence ATGGCCTCCAACTTTAAGAAGGCAAACATGGCATCAAGTTCTCAGCGAAAAAGAATGAGCCCTAAGCCTGAGCTTACTGAAGAGCAAAAGCAGGAGATCCGGGAAGCTTTTGATCTTTTCGATGCGGATGGAACTGGCACCATAGATGTTAAAGAACTGAAGGTGGCAATGAGGGCCCTGGGCTTTGAACCCAAGAAAGAAGAAATTAAGAAAATGATAAGTGAAATTGATAAGGAAGGGACAGGAAAAATGAAC
Vector pATGen (puc19-derived cloning vector)
NCBI NP_004335.1
ECLASS 10.1 32160414
ECLASS 11.0 32160414
UNSPSC 41105324
Alias CALT,CEN2
Similar products CETN2, CALT, CEN2, ATGD0221-10ug, ATGD0221-20ug, ATGD0221-50ug, ATGD0221-100ug, ATGD0221-250ug, ATGD0221-500ug, ATGD0221-1mg, ATGD0221-10, ATGD0221-20, ATGD0221-50, ATGD0221-100, ATGD0221-250, ATGD0221-500, ATGD0221-1
Available
Manufacturer - Type
cDNAs
Manufacturer - Category
cDNA
Storage Conditions
Store the plasmid at -20C.
Description
Caltractin belongs to a family of calcium-binding proteins and is a structural component of the centrosome. The high level of conservation from algae to humans and its association with the centrosome suggested that caltractin plays a fundamental role in the structure and function of the microtubule-organizing center, possibly required for the proper duplication and segregation of the centrosome.
Formulation
Lyophilized
Antigen Species
Human
Gene Category
Cell Cycle
OMIM Number
300006
Chromosome Location
Xq28
DNA size
519bp
Vector description
This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
Preparation before usage
1. Centrifuge at 7000rpm for 1 minute.; ; 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA.; ; Each tube contains approximately 10ug of lyophilized plasmid.
Species of Protein
Human
Translation Sequence
MASNFKKANM ASSSQRKRMS PKPELTEEQK QEIREAFDLF DADGTGTIDV KELKVAMRAL GFEPKKEEIK KMISEIDKEG TGKMNFGDFL TVMTQKMSEK DTKEEILKAF KLFDDDETGK ISFKNLKRVA KELGENLTDE ELQEMIDEAD RDGDGEVSEQ EFLRIMKKTS LY
RNA Reference Number
NM_004344.1
Nucleotide Sequence
ATGGCCTCCAACTTTAAGAAGGCAAACATGGCATCAAGTTCTCAGCGAAAAAGAATGAGCCCTAAGCCTGAGCTTACTGAAGAGCAAAAGCAGGAGATCCGGGAAGCTTTTGATCTTTTCGATGCGGATGGAACTGGCACCATAGATGTTAAAGAACTGAAGGTGGCAATGAGGGCCCTGGGCTTTGAACCCAAGAAAGAAGAAATTAAGAAAATGATAAGTGAAATTGATAAGGAAGGGACAGGAAAAATGAACTTTGGTGACTTTTTAACTGTGATGACCCAGAAAATGTCTGAGAAAGATACTAAAGAAGAAATCCTGAAAGCTTTCAAGCTCTTTGATGATGATGAAACTGGGAAGATTTCGTTCAAAAATCTGAAACGCGTGGCCAAGGAGTTGGGTGAGAACCTGACTGATGAGGAGCTGCAGGAAATGATTGATGAAGCTGATCGAGATGGAGATGGAGAGGTCAGTGAGCAAGAGTTCCTGCGCATCATGAAAAAGACCAGCCTCTATTAA
Manufacturer - Search Terms
CETN2, CALT, CEN2, CETN2, ATGD0221-10ug, ATGD0221-20ug, ATGD0221-50ug, ATGD0221-100ug, ATGD0221-250ug, ATGD0221-500ug, ATGD0221-1mg, ATGD0221-10, ATGD0221-20, ATGD0221-50, ATGD0221-100, ATGD0221-250, ATGD0221-500, ATGD0221-1

Note: The presented information and documents (Manual, Product Datasheet, Safety Datasheet and Certificate of Analysis) correspond to our latest update and should serve for orientational purpose only. We do not guarantee the topicality. We would kindly ask you to make a request for specific requirements, if necessary.

All products are intended for research use only (RUO). Not for human, veterinary or therapeutic use.

Amount: 10 ug
Available: In stock
available

Compare

Add to wishlist

Get an offer

Request delivery time

Ask a technical question

Submit a bulk request

Questions about this Product?
 
Close