Comparison

CIB2 cDNA

Item no. NKM-ATGD0223-10ug
Manufacturer NKMAX
Amount 10 ug
Category
Type cDNA
Format Lyophilized
Specific against Human (Homo sapiens)
Sequence ATGGGGAACAAGCAGACCATCTTCACCGAAGAGCAGCTAGACAACTACCAGGACTGCACCTTCTTCAATAAGAAGGACATCCTCAAGCTGCATTCGCGATTCTATGAGCTGGCCCCCAACCTCGTCCCAATGGACTACAGGAAGAGCCCCATCGTCCACGTGCCCATGAGCCTCATCATCCAGATGCCAGAGCTCCGGGAGAATCCCTTCAAAGAAAGGATCGTGGCGGCGTTTTCCGAGGATGGTGAGGGGAAC
Vector pATGen (puc19-derived cloning vector)
NCBI NP_006374.1
ECLASS 10.1 32160414
ECLASS 11.0 32160414
UNSPSC 41105324
Alias DFNB48,KIP2,USH1J
Similar products KIP2, CIB2, USH1J, DFNB48, ATGD0223-10ug, ATGD0223-20ug, ATGD0223-50ug, ATGD0223-100ug, ATGD0223-250ug, ATGD0223-500ug, ATGD0223-1mg, ATGD0223-10, ATGD0223-20, ATGD0223-50, ATGD0223-100, ATGD0223-250, ATGD0223-500, ATGD0223-1
Available
Manufacturer - Type
cDNAs
Manufacturer - Category
cDNA
Storage Conditions
Store the plasmid at -20C.
Description
The protein encoded by CIB2 is similar to that of KIP/CIB, calcineurin B, and calmodulin. The encoded protein is a calcium-binding regulatory protein that interacts with DNA-dependent protein kinase catalytic subunits (DNA-PKcs), and it is involved in photoreceptor cell maintenance. Mutations in this gene cause deafness, autosomal recessive, 48 (DFNB48), and also Usher syndrome 1J (USH1J). Alternative splicing results in multiple transcript variants.
Formulation
Lyophilized
Antigen Species
Human
Gene Category
Signal Transduction
OMIM Number
605564
Chromosome Location
15q24
DNA size
564bp
Vector description
This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
Preparation before usage
1. Centrifuge at 7000rpm for 1 minute.; ; 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA.; ; Each tube contains approximately 10ug of lyophilized plasmid.
Species of Protein
Human
Translation Sequence
MGNKQTIFTE EQLDNYQDCT FFNKKDILKL HSRFYELAPN LVPMDYRKSP IVHVPMSLII QMPELRENPF KERIVAAFSE DGEGNLTFND FVDMFSVLCE SAPRELKANY AFKIYDFNTD NFICKEDLEL TLARLTKSEL DEEEVVLVCD KVIEEADLDG DGKLGFADFE DMIAKAPDFL STFHIRI
RNA Reference Number
NM_006383.3
Nucleotide Sequence
ATGGGGAACAAGCAGACCATCTTCACCGAAGAGCAGCTAGACAACTACCAGGACTGCACCTTCTTCAATAAGAAGGACATCCTCAAGCTGCATTCGCGATTCTATGAGCTGGCCCCCAACCTCGTCCCAATGGACTACAGGAAGAGCCCCATCGTCCACGTGCCCATGAGCCTCATCATCCAGATGCCAGAGCTCCGGGAGAATCCCTTCAAAGAAAGGATCGTGGCGGCGTTTTCCGAGGATGGTGAGGGGAACCTCACTTTCAACGACTTTGTGGACATGTTTTCCGTGCTCTGCGAGTCGGCTCCCCGAGAGCTCAAGGCAAACTATGCCTTCAAGATCTATGACTTCAACACTGACAACTTCATCTGCAAGGAGGACCTGGAGCTGACGCTGGCCCGGCTCACTAAGTCAGAGCTGGATGAGGAGGAGGTGGTGCTTGTGTGCGACAAGGTCATTGAGGAGGCTGACTTGGACGGTGACGGCAAGCTGGGCTTTGCTGACTTCGAGGACATGATTGCCAAGGCCCCTGACTTCCTCAGCACTTTCCACATCCGGATCTGA
Manufacturer - Search Terms
CIB2, DFNB48, KIP2, USH1J, CIB2, ATGD0223-10ug, ATGD0223-20ug, ATGD0223-50ug, ATGD0223-100ug, ATGD0223-250ug, ATGD0223-500ug, ATGD0223-1mg, ATGD0223-10, ATGD0223-20, ATGD0223-50, ATGD0223-100, ATGD0223-250, ATGD0223-500, ATGD0223-1

Note: The presented information and documents (Manual, Product Datasheet, Safety Datasheet and Certificate of Analysis) correspond to our latest update and should serve for orientational purpose only. We do not guarantee the topicality. We would kindly ask you to make a request for specific requirements, if necessary.

All products are intended for research use only (RUO). Not for human, veterinary or therapeutic use.

Amount: 10 ug
Available: In stock
available

Compare

Add to wishlist

Get an offer

Request delivery time

Ask a technical question

Submit a bulk request

Questions about this Product?
 
Close