Comparison

PPP3R2 cDNA

Item no. NKM-ATGD0242-10ug
Manufacturer NKMAX
Amount 10 ug
Category
Type cDNA
Format Lyophilized
Specific against Human (Homo sapiens)
Sequence ATGTCCACAATGGGAAACGAGGCCAGTTACCCGGCGGAGATGTGCTCCCACTTTGACAATGATGAAATTAAAAGGCTGGGCAGGAGGTTTAAGAAGTTGGACTTGGACAAATCAGGGTCTCTGAGCGTGGAGGAGTTCATGTCCCTGCCGGAGCTGCGCCACAACCCGTTGGTGCGGCGAGTGATCGACGTCTTCGACACCGACGGTGATGGAGAAGTGGACTTCAAGGAATTCATCCTGGGGACCTCCCAGTTC
Vector pATGen (puc19-derived cloning vector)
NCBI NP_671709.1
ECLASS 10.1 32160414
ECLASS 11.0 32160414
UNSPSC 41105324
Alias PPP3RL
Similar products PPP3R2, PPP3RL, ATGD0242-10ug, ATGD0242-20ug, ATGD0242-50ug, ATGD0242-100ug, ATGD0242-250ug, ATGD0242-500ug, ATGD0242-1mg, ATGD0242-10, ATGD0242-20, ATGD0242-50, ATGD0242-100, ATGD0242-250, ATGD0242-500, ATGD0242-1
Available
Manufacturer - Type
cDNAs
Manufacturer - Category
cDNA
Storage Conditions
Store the plasmid at -20C.
Description
PPP3R2 (Protein Phosphatase 3, Regulatory Subunit B, Beta) is a Protein Coding gene. Among its related pathways are MAPK signaling pathway and GPCR Pathway. GO annotations related to this gene include calcium ion binding. An important paralog of this gene is CHP1.
Formulation
Lyophilized
Antigen Species
Human
Gene Category
Signal Transduction
OMIM Number
613821
Chromosome Location
9q31.1
DNA size
522bp
Vector description
This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
Preparation before usage
1. Centrifuge at 7000rpm for 1 minute.; ; 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA.; ; Each tube contains approximately 10ug of lyophilized plasmid.
Species of Protein
Human
Translation Sequence
MSTMGNEASY PAEMCSHFDN DEIKRLGRRF KKLDLDKSGS LSVEEFMSLP ELRHNPLVRR VIDVFDTDGD GEVDFKEFIL GTSQFSVKGD EEQKLRFAFS IYDMDKDGYI SNGELFQVLK MMVGNNLTDW QLQQLVDKTI IILDKDGDGK ISFEEFSAVV RDLEIHKKLV LIV
RNA Reference Number
NM_147180.3
Nucleotide Sequence
ATGTCCACAATGGGAAACGAGGCCAGTTACCCGGCGGAGATGTGCTCCCACTTTGACAATGATGAAATTAAAAGGCTGGGCAGGAGGTTTAAGAAGTTGGACTTGGACAAATCAGGGTCTCTGAGCGTGGAGGAGTTCATGTCCCTGCCGGAGCTGCGCCACAACCCGTTGGTGCGGCGAGTGATCGACGTCTTCGACACCGACGGTGATGGAGAAGTGGACTTCAAGGAATTCATCCTGGGGACCTCCCAGTTCAGCGTCAAGGGCGACGAGGAGCAGAAGTTGAGGTTTGCGTTCAGCATTTACGACATGGATAAAGATGGCTACATTTCCAACGGGGAGCTCTTCCAGGTGCTGAAGATGATGGTGGGCAACAACCTGACGGACTGGCAGCTCCAGCAGCTGGTCGACAAAACCATCATCATCCTGGACAAGGATGGCGATGGGAAGATATCCTTTGAGGAATTCAGTGCTGTGGTCAGAGACCTGGAGATCCACAAGAAGCTGGTCCTCATCGTATGA
Manufacturer - Search Terms
PPP3R2, PPP3RL, PPP3R2, ATGD0242-10ug, ATGD0242-20ug, ATGD0242-50ug, ATGD0242-100ug, ATGD0242-250ug, ATGD0242-500ug, ATGD0242-1mg, ATGD0242-10, ATGD0242-20, ATGD0242-50, ATGD0242-100, ATGD0242-250, ATGD0242-500, ATGD0242-1

Note: The presented information and documents (Manual, Product Datasheet, Safety Datasheet and Certificate of Analysis) correspond to our latest update and should serve for orientational purpose only. We do not guarantee the topicality. We would kindly ask you to make a request for specific requirements, if necessary.

All products are intended for research use only (RUO). Not for human, veterinary or therapeutic use.

Amount: 10 ug
Available: In stock
available

Compare

Add to wishlist

Get an offer

Request delivery time

Ask a technical question

Submit a bulk request

Questions about this Product?
 
Close