Comparison

ALOX12B

Item no. CSB-CL001618HU
Manufacturer Cusabio
Amount 10 ug plasmid + 200 ul Glycerol
Category
Type Proteins
Specific against other
Sequence atggccacctacaaagtcagggtggccacaggcaccgacctcttgtcgggaacacgggactccatctcactgaccattgtggggacacaaggagagagccataagcagctgctgaaccactttgggagagactttgcaactggggcggtgggccagtacaccgtgcagtgccctcaggacctgggtgagctcatcatcatccgcctgcacaaagagcggtacgccttcttccccaaggacccttggtactgcaac
Vector pUC
ECLASS 10.1 32160409
ECLASS 11.0 32160409
UNSPSC 12352202
Similar products ALOX12B
Available
Length
2106

Note: The presented information and documents (Manual, Product Datasheet, Safety Datasheet and Certificate of Analysis) correspond to our latest update and should serve for orientational purpose only. We do not guarantee the topicality. We would kindly ask you to make a request for specific requirements, if necessary.

All products are intended for research use only (RUO). Not for human, veterinary or therapeutic use.

Amount: 10 ug plasmid + 200 ul Glycerol
Available: In stock
available

Compare

Add to wishlist

Get an offer

Request delivery time

Ask a technical question

Submit a bulk request

Questions about this Product?
 
Close