STAT1

Item no.	CSB-CL022810HU
Manufacturer	Cusabio
Amount	10 ug plasmid + 200 ul Glycerol
Category	Peptides & Proteins Recombinant Proteins
Type	Proteins
Specific against	other
Sequence	atgtctcagtggtacgaacttcagcagcttgactcaaaattcctggagcaggttcaccagctttatgatgacagttttcccatggaaatcagacagtacctggcacagtggttagaaaagcaagactgggagcacgctgccaatgatgtttcatttgccaccatccgttttcatgacctcctgtcacagctggatgatcaatatagtcgcttttctttggagaataacttcttgctacagcataacataaggaaa
Vector	pENTR223.1
ECLASS 10.1	32160409
ECLASS 11.0	32160409
UNSPSC	12352202
Similar products	STAT1
Available
Length	2139

Note: The presented information and documents (Manual, Product Datasheet, Safety Datasheet and Certificate of Analysis) correspond to our latest update and should serve for orientational purpose only. We do not guarantee the topicality. We would kindly ask you to make a request for specific requirements, if necessary.

All products are intended for research use only (RUO). Not for human, veterinary or therapeutic use.

Request Data Sheet

CSB-CL022810HU-datasheet.pdf

Request safety datasheet

Simple Order Order Subscription

Amount: 10 ug plasmid + 200 ul Glycerol

available

Delivery expected until 9/4/2025

Compare

Add to wishlist

Get an offer

Request delivery time