Comparison

MIRacle rno-miR-3568 miRNA Agomir/Antagomir

Item no. ACG-AM5180
Manufacturer AcceGen
Amount 1 ea
Quantity options 2 OD 4 OD 5 OD
Category
Type RNA
Specific against other
ECLASS 10.1 32160414
ECLASS 11.0 32160414
UNSPSC 41105324
Available
Shipping Temperature
Ice pack
Description
Accession Number: MIMAT0017848
Mature Sequence UGUUCUUCCCGUGCAGAAGCAG
rno-miR-3568 are small non-coding RNAs of 20–22 nucleotides, typically excised from 60–110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression.
AcceGen Biotech has extended experience in agomir/antagomir synthesis services that cover all human, mouse and rat miRNAs in the current miRbase (http://www.mirbase.org/). Compared to standard miRNA mimics and inhibitors, agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.
Deliverables: Agomir and/or antagomir, DEPC H2O.
1 OD corresponds to 33 ug.

Note: The presented information and documents (Manual, Product Datasheet, Safety Datasheet and Certificate of Analysis) correspond to our latest update and should serve for orientational purpose only. We do not guarantee the topicality. We would kindly ask you to make a request for specific requirements, if necessary.

All products are intended for research use only (RUO). Not for human, veterinary or therapeutic use.

 
Close