« Back
Home /
SiRNA Negative Control

SiRNA Negative Control

Item no.	HY-150150-10mg
Manufacturer	MedChem Express
Amount	10 mg
Quantity options	10 mg 1 mg 5 mg
Category	Reagents & Chemicals Biochemicals Controls
Type	Control
Specific against	other
Purity	96.40
Smiles	[RNA, (UUCUCCGAACGUGUCACGUUU), complex with RNA, (ACGUGACACGUUCGGAGAAUU) (1:1)]
ECLASS 10.1	42021590
ECLASS 11.0	42021590
UNSPSC	41105330
Shipping Condition	Cool pack
Available
Manufacturer - Type	Oligonucleotides
Manufacturer - Applications	COVID-19-immunoregulation
Manufacturer - Targets	Small Interfering RNA (siRNA)
Shipping Temperature	Blue Ice
Storage Conditions	-20°C (Powder, sealed storage, away from moisture)
Molecular Weight	13323 (1mg=75nmol; 5mg=375nmol)
Product Description	SiRNA Negative Control is a siRNA of 21 nucleotides, and can be used as a negative control. SiRNA Negative Control has no homology to most known gene sequence. SiRNA Negative Control is available with fluorescent labels, allowing rapid assessment of transfection efficiency. SiRNA Negative Control can be used in human, mouse and rat cells in vitro. SiRNA Negative Control can be used as experimental control benchmark, verification of experimental reliability and standardization reference. SiRNA Negative Control is a common negative control used in most research articles.
Manufacturer - Research Area	Inflammation/Immunology
Solubility	H2O: 100 mg/mL (ultrasonic)
Manufacturer - Pathway	Epigenetics
Clinical information	No Development Reported

Note: The presented information and documents (Manual, Product Datasheet, Safety Datasheet and Certificate of Analysis) correspond to our latest update and should serve for orientational purpose only. We do not guarantee the topicality. We would kindly ask you to make a request for specific requirements, if necessary.

All products are intended for research use only (RUO). Not for human, veterinary or therapeutic use.

Request Data Sheet

Request product datasheet

HY-150150-10mg-safety-datasheet.pdf