Comparison

SARS-CoV-2 (2019-nCoV) Nucleocapsid ORF mammalian expression plasmid (Codon Optimized) European Partner

Item no. VG40588-UT
Manufacturer Sino Biological
Amount 1 Unit
Category
Type Clone
Specific against other
ECLASS 10.1 32160414
ECLASS 11.0 32160414
UNSPSC 41105324
Alias coronavirus NP cDNA ORF Clone,2019-nCoV,coronavirus Nucleocapsid cDNA ORF Clone,2019-nCoV,coronavirus Nucleoprotein cDNA ORF Clone,2019-nCoV,cov np cDNA ORF Clone,2019-nCoV,ncov NP cDNA ORF Clone,2019-nCoV,NCP-CoV Nucleocapsid cDNA ORF Clone,2019-nCoV,novel coronavirus NP cDNA ORF Clone,2019-nCoV,novel coronavirus Nucleocapsid cDNA ORF Clone,2019-nCoV,novel coronavirus Nucleoprotein cDNA ORF Clone,2019-nCoV,np cDNA ORF Clone,2019-nCoV,nucleocapsid cDNA ORF Clone,2019-nCoV,Nucleoprotein cDNA ORF Clone,2019-nCoV
Available
Manufacturer - Type
Gene
Storage Conditions
The lyophilized plasmid can be stored at ambient temperature for three months.
Gene
RefSeq ORF Size 1260 bp
Sequence Description A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with QHD43423.2 except for the point mutations: G355A.
Description Full length Clone DNA of SARS-CoV-2 (2019-nCoV) Nucleoprotein / NP.
Plasmid
Promoter Enhanced CMV mammalian cell promoter
Vector pCMV3-untagged
Restriction Sites KpnI + XbaI(6.1kb+1.26kb)
Sequencing Primers T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Quality Control The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin

Note: The presented information and documents (Manual, Product Datasheet, Safety Datasheet and Certificate of Analysis) correspond to our latest update and should serve for orientational purpose only. We do not guarantee the topicality. We would kindly ask you to make a request for specific requirements, if necessary.

All products are intended for research use only (RUO). Not for human, veterinary or therapeutic use.

Amount: 1 Unit
Available: In stock
available

Compare

Add to wishlist

Get an offer

Request delivery time

Ask a technical question

Submit a bulk request

Questions about this Product?
 
Close