Comparison

SARS-CoV-2 (2019-nCoV) Spike S1 ORF mammalian expression plasmid (Codon Optimized) European Partner

Manufacturer Sino Biological
Category
Type Clone
Specific against other
Amount 1Unit
Item no. VG40591-UT
eClass 6.1 32160414
eClass 9.0 32160414
Available
Gene
RefSeq ORF Size 2058 bp
Sequence Description A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system.The translated amino acid sequence is identical with QHD43416.1(1-685aa)
Description Full length Clone DNA of SARS-CoV-2 (2019-nCoV) Spike(S1).
Plasmid
Promoter Enhanced CMV mammalian cell promoter
Vector pCMV3-untagged
Restriction Sites KpnI + XbaI(6.1kb+2.06kb)
Sequencing Primers T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Quality Control The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Note: The presented information and documents (Manual, Product Datasheet, Safety Datasheet and Certificate of Analysis) correspond to our latest update and should serve for orientational purpose only. We do not guarantee the topicality. We would kindly ask you to make a request for specific requirements, if necessary.

All products are intended for research use only (RUO). Not for human, veterinary or therapeutic use.

Amount: 1Unit
Available: In stock
available

Delivery expected until 6/20/2024 

Compare

Add to wishlist

Get an offer

Request delivery time

Ask a technical question

Submit a bulk request

Questions about this Product?
 
Close