« Back
Home /
SARS-CoV-2 (2019-nCoV) Spike S1 ORF mammalian expression plasmid (Codon Optimized)

SARS-CoV-2 (2019-nCoV) Spike S1 ORF mammalian expression plasmid (Codon Optimized)

Manufacturer	Sino Biological
Category	Infectious Diseases Viral Infections Coronavirus (COVID-19) Nucleic Acids Plasmid & Vectors
Type	Clone
Specific against	other
Amount	1Unit
Item no.	VG40591-UT
eClass 6.1	32160414
eClass 9.0	32160414
Available
Gene	RefSeq ORF Size 2058 bp Sequence Description A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system.The translated amino acid sequence is identical with QHD43416.1(1-685aa) Description Full length Clone DNA of SARS-CoV-2 (2019-nCoV) Spike(S1).
Plasmid	Promoter Enhanced CMV mammalian cell promoter Vector pCMV3-untagged Restriction Sites KpnI + XbaI(6.1kb+2.06kb) Sequencing Primers T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG) Quality Control The plasmid is confirmed by full-length sequencing.
Screening	Antibiotic in E.coli Ampicillin Antibiotic in Mammalian cell Hygromycin
Storage	The lyophilized plasmid can be stored at ambient temperature for three months.

Note: The presented information and documents (Manual, Product Datasheet, Safety Datasheet and Certificate of Analysis) correspond to our latest update and should serve for orientational purpose only. We do not guarantee the topicality. We would kindly ask you to make a request for specific requirements, if necessary.

All products are intended for research use only (RUO). Not for human, veterinary or therapeutic use.

Request Data Sheet

VG40591-UT-datasheet.pdf

Request safety datasheet

Simple Order Order Subscription

Amount: 1Unit

available

Delivery expected until 5/16/2024