« Back
Home /
SARS-CoV-2 (2019-nCoV) EndoRNAse/EN Gene ORF cDNA clone expression plasmid

SARS-CoV-2 (2019-nCoV) EndoRNAse/EN Gene ORF cDNA clone expression plasmid

Item no.	VG40597-UT
Manufacturer	Sino Biological
Amount	1 Unit
Category	Infectious Diseases Viral Infections Coronavirus (COVID-19) Nucleic Acids DNA cDNA
Type	cDNA Clone
Specific against	other
ECLASS 10.1	32160414
ECLASS 11.0	32160414
UNSPSC	41106309
Available
Manufacturer - Type	Gene
Storage Conditions	The lyophilized plasmid can be stored at ambient temperature for three months.
Gene	NCBI Ref Seq NC_045512.2(19621-20658nt) RefSeq ORF Size 1044 bp Sequence Description Identical with the Gene Bank Ref. ID sequence. Description Full length Clone DNA of SARS-CoV-2 (2019-nCoV) EndoRNAse/EN .
Plasmid	Promoter Enhanced CMV mammalian cell promoter Vector pCMV3-untagged Restriction Sites KpnI + XbaI(6.1kb+1.05kb) Sequencing Primers T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG) Quality Control The plasmid is confirmed by full-length sequencing.
Screening	Antibiotic in E.coli Ampicillin Antibiotic in Mammalian cell Hygromycin

Note: The presented information and documents (Manual, Product Datasheet, Safety Datasheet and Certificate of Analysis) correspond to our latest update and should serve for orientational purpose only. We do not guarantee the topicality. We would kindly ask you to make a request for specific requirements, if necessary.

All products are intended for research use only (RUO). Not for human, veterinary or therapeutic use.

Request Data Sheet

VG40597-UT-datasheet.pdf

Request safety datasheet

Simple Order Order Subscription

Amount: 1 Unit

available

Compare

Add to wishlist

Get an offer

Request delivery time

Ask a technical question