MIRacle rno-miR-3559-5p miRNA Agomir/Antagomir

-20C

Accession Number: MIMAT0017827
Mature Sequence UGACAGACUUAGUACUACAUGA
rno-miR-3559-5p are small non-coding RNAs of 20–22 nucleotides, typically excised from 60–110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression.
AcceGen Biotech has extended experience in agomir/antagomir synthesis services that cover all human, mouse and rat miRNAs in the current miRbase (http://www.mirbase.org/). Compared to standard miRNA mimics and inhibitors, agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.
Deliverables: Agomir and/or antagomir, DEPC H2O.
1 OD corresponds to 33 ug.