XAGE1A

Manufacturer	Cusabio
Category	Peptides & Proteins Recombinant Proteins
Type	Proteins
Specific against	other
Amount	10 ug plasmid + 200ul Glycerol
Item no.	CSB-CL872552HU
eClass 6.1	34160400
eClass 9.0	42020190
Available
Gene ID	653219
Vector	Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence	atggagagccccaaaaagaagaaccagcagctgaa agtcgggatcctacacctgggcagcagacagaaga agatcaggatacagctgagatcccagtgcgcgaca tggaaggtgatctgcaagagctgcatcagtcaaac accggggataaatctggatttgggttccggcgtca aggtgaagataatacctaaagaggaacactgtaaa atgccagaagcaggtgaagagcaaccacaagttta
Length	246
Accession No.	BC009538

Note: The presented information and documents (Manual, Product Datasheet, Safety Datasheet and Certificate of Analysis) correspond to our latest update and should serve for orientational purpose only. We do not guarantee the topicality. We would kindly ask you to make a request for specific requirements, if necessary.

All products are intended for research use only (RUO). Not for human, veterinary or therapeutic use.

Request Data Sheet

Request product datasheet

Request safety datasheet

Simple Order Order Subscription

Amount: 10 ug plasmid + 200ul Glycerol

available

Request delivery time