Comparison

MIRacle hsa-miR-1237-5p miRNA Agomir/Antagomir

Item no. ACG-AM1555-2OD
Manufacturer AcceGen
Amount 2 OD
Quantity options 2 OD 4 OD 5 OD
Category
Type RNA
Applications other
Specific against Human (Homo sapiens)
ECLASS 10.1 32160414
ECLASS 11.0 32160414
UNSPSC 41105324
Available
Manufacturer - Applications
For research use only
Description
< strong> MicroRNA: hsa-miR-1237-5p< /strong> Accession Number: MIMAT0022946 Mature Sequence: CGGGGGCGGGGCCGAAGCGCG hsa-miR-1237-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-1237-5p in miRBase. & nbsp; < strong> What is MicroRNA Agomir/Antagomir?< /strong> MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. & nbsp; < strong> Why choose hsa-miR-1237-5p miRNA Agomir/Antagomir from AcceGen?< /strong> AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Note: The presented information and documents (Manual, Product Datasheet, Safety Datasheet and Certificate of Analysis) correspond to our latest update and should serve for orientational purpose only. We do not guarantee the topicality. We would kindly ask you to make a request for specific requirements, if necessary.

All products are intended for research use only (RUO). Not for human, veterinary or therapeutic use.

Amount: 2 OD
Available: In stock
available

Delivery expected until 9/4/2025 

Compare

Add to wishlist

Get an offer

Request delivery time

Ask a technical question

Submit a bulk request

Questions about this Product?
 
Close