Human EIF4EBP2 Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged

Manufacturer Sino Biological
Category Products / Clone
Type cDNA Clone
Specific against Human
Amount 1 Unit
ArtNr HG14489-G-H
Eclass 6.1 34160990
Eclass 9.0 32160414
Available
Gene Bank Ref.ID
BC005057
Gene Synonym
4EBP2, PHASII
Molecule
EIF4EBP2
cDNA Size
363
Vector
pCMV/hygro-His
cDNA Description
ORF Clone of Homo sapiens eukaryotic translation initiation factor 4E binding protein 2 DNA.
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Sequence
ATGTCCTCGT CAGCCGGCAG CGGCCACCAG CCCAGCCAGA GCCGCGCCAT CCCCACCCGC ACCGTGGCCA TCAGCGACGC CGCGCAGCTA CCTCATGACT ATTGCACCAC GCCCGGGGGG ACGCTCTTCT CCACCACACC GGGAGGAACT CGAATCATTT ATGACAGAAA GTTTCTGTTG GATCGTCGCA ATTCTCCCAT GGCTCAGACC CCACCCTGCC ACCTGCCCAA TATCCCAGGA GTCACTAGCC CTGGCACCTT AATTGAAGAC TCCAAAGTAG AAGTAAACAA TTTGAACAAC TTGAACAATC ACGACAGGAA ACATGCAGTT GGGGATGATG CTCAGTTCGA GATGGACATC GCTCACCATC ACCACCATCA TCACCACCAT CACTAA
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note
1. GCT was the nucleotide residue from the restriction site during plasmid construction, which has no influence on protein expression. 2. His Tag
Restriction site
KpnI + XhoI
Amount: 1 Unit
Available: In stock
Listprice: €98.28
Price: €98.28
lieferbar

Get an offer

Technische Fragen zu diesem Produkt?


Salesmanager: Arne Pelz

Email: sales@hoelzel.de

Instruction sheet

HG14489-G-H.pdf