Human GSTA1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

Manufacturer Sino Biological
Category Products / Clone
Type cDNA Clone
Specific against Human
Amount 1 Unit
ArtNr HG15237-G-F
Eclass 6.1 34160990
Eclass 9.0 32160414
Available
Gene Bank Ref.ID
BC053578
Gene Synonym
GST2, GTH1, GSTA1-1
Molecule
GSTA1
cDNA Size
669
Vector
pCMV/hygro-FLAG
cDNA Description
ORF Clone of Homo sapiens glutathione S-transferase alpha 1 DNA.
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Sequence
ATGGCAGAGA AGCCCAAGCT CCACTACTTC AATGCACGGG GCAGAATGGA GTCCACCCGG TGGCTCCTGG CTGCAGCTGG AGTAGAGTTT GAAGAGAAAT TTATAAAATC TGCAGAAGAT TTGGACAAGT TAAGAAATGA TGGATATTTG ATGTTCCAGC AAGTGCCAAT GGTTGAGATT GATGGGATGA AGCTGGTGCA GACCAGAGCC ATTCTCAACT ACATTGCCAG CAAATACAAC CTCTATGGGA AAGACATAAA GGAGAGAGCC CTGATTGATA TGTATATAGA AGGTATAGCA GATTTGGGTG AAATGATCCT CCTTCTGCCC GTATGTCCAC CTGAGGAAAA AGATGCCAAG CTTGCCTTGA TCAAAGAGAA AATAAAAAAT CGCTACTTCC CTGCCTTTGA AAAAGTCTTA AAGAGCCATG GACAAGACTA CCTTGTTGGC AACAAGCTGA GCCGGGCTGA CATTCATCTG GTGGAACTTC TCTACTACGT CGAGGAGCTT GACTCCAGTC TTATCTCCAG CTTCCCTCTG CTGAAGGCCC TGAAAACCAG AATCAGCAAC CTGCCCACAG TGAAGAAGTT TCTACAGCCT GGCAGCCCAA GGAAGCCTCC CATGGATGAG AAATCTTTAG AAGAAGCAAG GAAGATTTTC AGGTTTGCTG ATTACAAGGA TGACGACGAT AAGTAA
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note
1. GCT was the nucleotide residue from the restriction site during plasmid construction, which has no influence on protein expression. 2. FLAG Tag
Restriction site
KpnI + XhoI
Amount: 1 Unit
Available: In stock
Listprice: €138.96
Price: €138.96
lieferbar

Get an offer

Technische Fragen zu diesem Produkt?


Salesmanager: Arne Pelz

Email: sales@hoelzel.de

Instruction sheet

HG15237-G-F.pdf